2 rationale for the delivery of antineoplastic agents by the intraperitonealroute as a treatment for intraperitoneal malignan

Báo cáo khoa học nông nghiệp " Nutrient recovery by rice crops as a treatment for aquaculture solid waste: crop yield, nutrient status and nutrient budgets " doc

Báo cáo khoa học nông nghiệp " Nutrient recovery by rice crops as a treatment for aquaculture solid waste: crop yield, nutrient status and nutrient budgets " doc

Ngày tải lên : 21/06/2014, 04:20
... season crops All fishpond solid waste was applied before planting as was 50 % of the inorganic P and K The remaining P and K was applied at panicle initiation stage at 35 days after sowing (DAS) ... standard methods for soil (Page et al 1982), plant analysis (Chapman and Pratt, 1961); water and wastes samples analysis followed methods for chemical analysis of water and wastes (MCAWW) EPA/600/4/79-020 ... revised March 1983 Statistical analysis was completed with IRRISTAT software version 5.1 by applying a balanced one-way ANOVA Nutrient (N, P, K) balances were calculated following the approach of Dobermann...
  • 24
  • 345
  • 0
ROMP based polymer nanoparticles for the targeted delivery of antitumor agents

ROMP based polymer nanoparticles for the targeted delivery of antitumor agents

Ngày tải lên : 23/08/2015, 18:48
... molecular level, together with an appreciation of the pathophysiology of normal and disease tissue will help to realize the full therapeutic potential of the post-genomics era.” • • • • Increased ... www.nlm.nih.gov/medlineplus/neuroblastoma.html Cancer affecting immature nerve cells, most commonly in the adrenal glands and the sympathetic nervous system ganglia of the abdomen Common drugs used to treat neuroblastoma: Cisplatin ... nm) relevant to therapeutic application • Sustained, tunable, temporal-controllable release of relevant anti-tumor agents from PNPs was observed upon incubation in acidic media • Drug-containing...
  • 53
  • 501
  • 0
Nanoparticles of biodegradable polymers for delivery of therapeutic agents and diagnostic sensitizers to cross the blood brain barrier (BBB) for chemotherapy and MRI of the brain

Nanoparticles of biodegradable polymers for delivery of therapeutic agents and diagnostic sensitizers to cross the blood brain barrier (BBB) for chemotherapy and MRI of the brain

Ngày tải lên : 26/11/2015, 22:48
... entourages the formation of the nanocapsule shell between the aqueous phase and the benzyl benzoate drops in the organic phase One advantage of interfacial polymerization may be the encapsulation of ... one of the most potent antitumor agents and has been apptroved by FDA for treatment of a wide spectrum of cancers, especially breast cancer, ovarian cancer, small cell and non small cell lung cancer ... type of nanoparticle formulation provides the available space that acts as a carrier for adsorption or absorption of the drug Emulsion polymerization can also be accomplished in an organic phase...
  • 93
  • 257
  • 0
Báo cáo y học: "Effect of corticosteroids on phlebitis induced by intravenous infusion of antineoplastic agents in rabbits"

Báo cáo y học: "Effect of corticosteroids on phlebitis induced by intravenous infusion of antineoplastic agents in rabbits"

Ngày tải lên : 26/10/2012, 09:57
... of the vein in out of animals In addition, there was inflammatory cell infiltration (Grades 1-3) in the proximal part of the vein in all animals and in the distal part of the vein in of the animals ... the animals Edema (Grades 1-3) was found in the proximal part of the vein in of the animals and in the distal part of the vein in of the animals Epidermal degeneration (Grades 1-3) was found ... inflammatory cell infiltration (Grades 1-3) at the proximal region of the vein in animas and at the distal region in of the animals, edema (Grade 3) at the proximal region in animal and edema (Grade...
  • 6
  • 711
  • 0
Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

Ngày tải lên : 15/03/2014, 21:20
... geographically concentrated in areas such as Silicon Valley, California, because the face-to-face networks are crucial for the cross fertilization of ideas Rosenfeld and Thomas, Searching for a Mate ... the ACS) The higher rate of interraciality in HCMST is mainly due to the fact that the HCMST survey was offered only in English, whereas the ACS was offered in a variety of languages Asians and ... women of a certain age a reasonable measure of the lack of availability of partners for single men of the same age group (and vice-versa)? Despite the existence of age discrepant couples, age homophily...
  • 50
  • 470
  • 0
Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot

Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot

Ngày tải lên : 09/08/2014, 03:24
... organ transplants Acknowledgements This research was supported in part by National Institutes of Health grant AI 41768, The Nora Eccles Treadwell Foundation, and the Arthritis Foundation-Southern ... Sakaguchi S, Fukuma K, Kuribayashi K, Masuda T: Organ-specific autoimmune diseases induced in mice by elimination of T cell subset I Evidence for the active participation of T cells in natural ... self-tolerance; deficit of a T cell subset as a possible cause of autoimmune disease J Exp Med 1985, 161:72-87 Kuniyasu Y, Takahashi T, Itoh M, Shimizu J, Toda G, Sakaguchi S: Naturally anergic and...
  • 6
  • 408
  • 0
Delivery of chemotherapeutic agents using drug-loaded irradiated tumor cells to treat murine ovarian tumors doc

Delivery of chemotherapeutic agents using drug-loaded irradiated tumor cells to treat murine ovarian tumors doc

Ngày tải lên : 10/08/2014, 05:21
... pGL3-basic (Promega) using the 5’ primer CGGAGATC TATGGAAGACGCCAAAAAC and the 3’ primer CGGGTTAACTTACACGGCGATCTTTCC The amplified luciferase cDNA was inserted into the BglII and HpaI sites of the ... image of the tumor cells at days of incubation The numbers at the top indicate identical trials of the same experiment (B) Bar graph depicting the measured expression of luciferase in the viable ... luminescence activity on a weekly basis from the day of MOSEC/luc cells challenge Statistical analysis All data expressed as mean ± SD are representative of at least two different experiments Comparisons...
  • 12
  • 166
  • 0
báo cáo khoa học: " Osteonecrosis of the jaw as a possible rare side effect of annual bisphosphonate administration for osteoporosis: A case report" ppsx

báo cáo khoa học: " Osteonecrosis of the jaw as a possible rare side effect of annual bisphosphonate administration for osteoporosis: A case report" ppsx

Ngày tải lên : 10/08/2014, 23:20
... Oral Maxillofac Surg 2003, 61(9):1115-1117 Advisory Task Force on Bisphosphonate-Related Osteonecrosis of the Jaws, American Association of Oral and Maxillofacial Surgeons: American Association ... http://www.jmedicalcasereports.com/content/5/1/477 Page of Figure a) intraoral examination of her left lower jaw with fistula formation and pus on palpation in region 38; b) panoramic radiograph with mixed radiopaque and radiolucent areas surrounding ... by mild to moderate pain on palpation A panoramic radiograph and cone beam computed tomography identified radiolucent areas at the resected apices of teeth 22 and 23 as well as the region surrounding...
  • 4
  • 233
  • 0
Báo cáo khoa hoc:" Evaluation of triblock copolymeric micelles of δvalerolactone and poly (ethylene glycol) as a competent vector for doxorubicin delivery against cancer" doc

Báo cáo khoa hoc:" Evaluation of triblock copolymeric micelles of δvalerolactone and poly (ethylene glycol) as a competent vector for doxorubicin delivery against cancer" doc

Ngày tải lên : 11/08/2014, 08:20
... using tetrahydrofuran (THF) as the eluent (1.0 ml/min) In addition, thermal stability of the polymer was measured by differential thermal analysis (DTA) and thermogravimetric analysis (TGA) using ... mean ± standard error on the mean (S.E.M) For cytotoxicity experiments the normalization of the data was done by considering the mean value of the untreated samples as Page 13 of 14 100% All other ... VEVDMs as indicated and incubated for 24, 48 and 72 h, respectively Following treatment the amount of formazan crystals formed was measured after h of MTT addition (10% v/v) by adding isopropyl alcohol...
  • 14
  • 252
  • 0
An analysis of nouns formed by suffixes in english   a case study of the textbook solutions   pre intermedite

An analysis of nouns formed by suffixes in english a case study of the textbook solutions pre intermedite

Ngày tải lên : 14/12/2013, 16:45
... learners a large of vocabulary and grammar There are many reading texts and basing on these reading texts, learners have the chance to know about the culture, the people of many countries in the ... female humans and animals Eg:  Lion (Noun): a large powerful animal of the cat family that hunts in group and lives in parts of Africa and southern Asia  Lioness (Noun): a female lion 15 g/ The ... professional learning environment and facilities, as well as all teachers in the Faculty of Foreign languages for giving enthusiasm and sympathies to lift us to be the better ones as we are today In addition,...
  • 63
  • 988
  • 3
Smoking and reproduction: The oviduct as a target of cigarette smoke ppt

Smoking and reproduction: The oviduct as a target of cigarette smoke ppt

Ngày tải lên : 05/03/2014, 17:20
... had a picomolar LOAEL in the ciliary beat frequency assay Many of the compounds in Table were also screened using a chick chorioallantoic membrane (CAM) assay that measures growth of the CAM and ... femtomolar range (Table 1) In general, if a chemical were inhibitory, it acted in all three bioassays, although the potency and efficacy for a particular chemical varied among the assays Some of the ... system in the bovine oviduct: a regulator of local contraction and gamete transport J Cardiovasc Pharmacol 2004, 44 Suppl 1:S248-51 111 Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Acosta TJ,...
  • 17
  • 733
  • 0
Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx

Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx

Ngày tải lên : 24/03/2014, 03:21
... Jurkat cells and the induction was repressed by all-trans-RA treatment in a dose-dependent manner (Fig 1A) FasL transcription was decreased at all-trans-RA concentrations as low as 0.01 lM, and ... substrate 4-methyl-lumbellifery-b-galactoside, and was normalized for protein content [30] A one-way analysis of variance was performed using GraphPad INSTATÒ (GraphPad Software, San Diego, CA, USA) ... cDNA was synthesized from lg total RNA using 100 ng random hexamer (Pharmacia, Uppsala, Sweden) The PCR primer sequences used were as follows FasL (forward: 5¢-ATGTTTCAGC TCTTCCACCTACAGAAGGA-3¢,...
  • 9
  • 481
  • 0
A Portrait of the Artist as a Young Man ppt

A Portrait of the Artist as a Young Man ppt

Ngày tải lên : 31/03/2014, 14:20
... was not like the smell of the old peasants who knelt at the back of the chapel at Sunday mass That was a smell of air and rain and turf and corduroy But they were very holy peasants They breathed ... had big voices and big boots and they studied trigonometry That was very far away First came the vacation and then the next term and then vacation again and then again another term and then again ... would be dark and sleeping There was cold night air in the chapel and the marbles were the colour the sea was at night The sea was cold day 16 A Portrait of the Artist as a Young Man and night:...
  • 317
  • 342
  • 0
The Project Gutenberg E Book of The Argentine as a Market, by N. L. Watson potx

The Project Gutenberg E Book of The Argentine as a Market, by N. L. Watson potx

Ngày tải lên : 28/06/2014, 19:20
... rise as, in all probability they will, a rise in wages will be imperative This, in the case of railways would mean an increase in rates, as there are few who are earning more than a reasonable ... in the concentration of trade in the capital All imports, for reasons that will be dealt with later, pass through the hands of the large houses in Buenos Aires, who act as sole agents for the ... charge of the work on the spot, and, as capital is usually forthcoming, the estancias are run in such a way as to yield the greatest possible return They are usually well-maintained, up-to-date...
  • 199
  • 354
  • 0
Báo cáo khoa học: " Application of ventriculoperitoneal shunt as a treatment for hydrocephalus in a dog with syringomyelia and Chiari I malformation" pptx

Báo cáo khoa học: " Application of ventriculoperitoneal shunt as a treatment for hydrocephalus in a dog with syringomyelia and Chiari I malformation" pptx

Ngày tải lên : 07/08/2014, 18:21
... tsom si ydalam siht dna sulahpecordyh latinegnoc ot desopsiderp era sauhauhihC aixata htiw detneserp saw muiravlac depahs-emod a htiw god auhauhihC a ,esac siht nI ]3[ erusserp lainarcartni eht ... sisenegohtap eht ,revewoh ,]9[ aileymognirys fo esuac gnidael a si noitamroflam I iraihC ]8[ ecnatsbus lamyhcnerap eht nihtiw eil yam ti ro lanac lartnec eht fo noitatalid a yb demrof eb yam ytivac ... noitainreh drawnwod eht sa denifed yllanoitidart neeb sah taht nigiro niatrecnu na fo redrosid a si noitamroflam I iraihC )2 giF( aileymognirys dna noitamroflam I iraihC osla tub ,selcirtnev laretal eht...
  • 4
  • 384
  • 0
Báo cáo toán học: "The number of graphs not containing K3,3 as a minor" pptx

Báo cáo toán học: "The number of graphs not containing K3,3 as a minor" pptx

Ngày tải lên : 07/08/2014, 21:20
... in the class of maximal K3,3 -minor-free graphs and we can use the number of planar graphs and the number of triangulations as lower bounds Determining the number (of graphs of sub-classes) of ... singularity analysis to obtain asymptotic estimates for the number (and properties) of the graphs in these classes The last section contains + + the enumeration of graphs not containing K3,3 as a ... classes can be obtained by considering (maximal) planar graphs Due to Kuratowski’s theorem [10] planar graphs are K3,3 - and K5 -minorfree Hence, the class of (maximal) planar graphs is contained...
  • 20
  • 248
  • 0
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx

báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx

Ngày tải lên : 09/08/2014, 01:24
... study, there was a significant association of age, grade, lymph node spread and vascular invasion with distant metastases free survival (MFS) in all invasive carcinomas and the subgroup of IDC in an ... metastases (44 years) was 10 years younger than patients without distant metastases (54 years) [p = 0.02] in the IDC group For all invasive carcinomas, the average age of patients with distant ... of distant metastases in all invasive carcinomas, the subgroup of invasive ductal carcinomas and in the node negative group when cyclin E was stratified as negative and positive (low/high) Many...
  • 9
  • 423
  • 0
Báo cáo y học: "Identification of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a binding protein for a 68-kDa Bacillus thuringiensis parasporal protein cytotoxic against leukaemic cells" potx

Báo cáo y học: "Identification of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a binding protein for a 68-kDa Bacillus thuringiensis parasporal protein cytotoxic against leukaemic cells" potx

Ngày tải lên : 10/08/2014, 05:21
... LaPorte JR, Barbay JK, Myers AG: Identification of GAPDH as a target protein of the saframycin antiproliferative agents PNAS 2004, 101(16):5862-5866 21 Lee D, Katayama H, Maeda M, Tanaka R, Yamashita ... Kitada S, Abe Y, Shimada H, Kusaka Y, Matsuo Y, Katayama H, Okumura S, Akao T, Mizuki E, Kuge O, Sasaguri Y, Ohba M, Ito A: Cytocidal Actions of Parasporin-2, an Anti-tumor Crystal Toxin from Bacillus ... Biophys Acta 2001, 1547:57-63 Page 11 of 11 22 Kitada S, Abe Y, Shimada H, Kusaka Y, Matsuo Y, Katayama H, Okumura S, Akao T, Mizuki E, Kuge O, Sasaguri Y, Ohba M, Ito A: Cytocidal actions of parasporin-2,...
  • 11
  • 366
  • 0
báo cáo khoa học: "Sub-cellular internalization and organ specific oral delivery of PABA nanoparticles by side chain variation" pdf

báo cáo khoa học: "Sub-cellular internalization and organ specific oral delivery of PABA nanoparticles by side chain variation" pdf

Ngày tải lên : 11/08/2014, 00:23
... to (black) The average grey values are equivalent to the ratio of total gray scale values per number of pixels Measuring the mean gray scale values, the total (sum of) gray scale values of entire ... http://www.jnanobiotechnology.com/content/9/1/10 Page of 12 Figure Uptake and accumulation of orally deliverable PABA nanomaterials (A) Uptake and accumulation of nanoparticles in eye, leg and wing imaginal discs, and (B) adult brain were ... cellular internalization of PABA conjugates is mediated through the clathrin-dependent endocytosis pathway Oral uptake of variable PABA nanomaterials in Drosophila Organic nano-assemblies have...
  • 12
  • 301
  • 0
Báo cáo y học: "Menstruating from the umbilicus as a rare case of primary umbilical endometriosis: a case report" pot

Báo cáo y học: "Menstruating from the umbilicus as a rare case of primary umbilical endometriosis: a case report" pot

Ngày tải lên : 11/08/2014, 14:21
... extravasation of the mucinous Umbilical endometriosis: endometriotic glands with metaplasia of the mucinous type and extravasation of the mucinous secretion into the adjacent stroma Majority of these ... presence of endometriotic glands with mucinous type metaplasia and extravasation of the mucinous secretion into the adjacent stroma (Figure 1) No epithelial atypia was seen and the excision appeared ... Endometriomas appear homogeneously hyperintense on T1-weighted sequences [10] MRI also has an advantage over laparoscopy for evaluating pelvic and extraperitoneal diseases, as well as lesions concealed...
  • 3
  • 383
  • 0